hiscribe sp6 rna kit (New England Biolabs)

New England Biolabs is a verified supplier

New England Biolabs manufactures this product

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

New England Biolabs hiscribe sp6 rna kit
Hiscribe Sp6 Rna Kit, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 102 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/hiscribe+sp6+kit/HiScribe+SP6+RNA+Synthesis+Kit/pmc13092972-85-47-52
Average 99 stars, based on 102 article reviews

hiscribe sp6 rna kit - by Bioz Stars, 2026-09

99/100 stars

Images

other:

Article Title: Interchromosomal interaction of homologous Stat92E alleles regulates transcriptional switch during stem-cell differentiation
Article Snippet: pWalium20-10XUAS-3XFLAG-dCas9-VPR vector (Addgene) was digested by NheI and SphI.

Article Title: Interchromosomal interaction of homologous Stat92E alleles regulates transcriptional switch during stem-cell differentiation
Article Snippet: PCR product was purified using Oligo Clean & Concentrator Kits (Zymo Research, D4060).

In Vitro:

Article Title: Genetically tractable embryonic cell lines from sea urchins Lytechinus variegatus and Strongylocentrotus purpuratus.
Article Snippet: Linearized plasmids were column-purifiedunderRNAse-free conditions using aZymoDNAclean and concentrator kit (Zymo, D4034). .. Linearized plasmids were used as a DNA template for in vitro transcription using the HiScribe SP6 Kit (New England Biolabs, E2070S) and capped with a 3′-O-Me-m7G(5’)ppp(5’)G RNA cap structure analog (New England Biolabs, S1411S) following manufacturer’s instructions (NewEnglandBiolabs, RNASynthesis Protocol, E2070).mRNA was columnpurifiedusing theZymoRNAclean and concentrator kit (Zymo, R1013) andquantifiedusing aQubit 4 Fluorometer andbroad rangeRNAkit (Invitrogen, Q10211). mRNA was aliquoted and stored at−80 °C. .. Lipid-mediated transfections were conducted with NPM1-RFP mRNA using LipofectamineTM MessengerMAXTM (Invitrogen, LMRNA001) according to the manufacturer’s recommendations.

Article Title: Genetically tractable embryonic cell lines from sea urchins Lytechinus variegatus and Strongylocentrotus purpuratus
Article Snippet: Linearized plasmids were column-purified under RNAse-free conditions using a Zymo DNA clean and concentrator kit (Zymo, D4034). .. Linearized plasmids were used as a DNA template for in vitro transcription using the HiScribe SP6 Kit (New England Biolabs, E2070S) and capped with a 3′-O-Me-m7G(5’)ppp(5’)G RNA cap structure analog (New England Biolabs, S1411S) following manufacturer’s instructions (New England Biolabs, RNA Synthesis Protocol, E2070). mRNA was column purified using the Zymo RNA clean and concentrator kit (Zymo, R1013) and quantified using a Qubit 4 Fluorometer and broad range RNA kit (Invitrogen, Q10211 ). mRNA was aliquoted and stored at −80 °C. .. Lipid-mediated transfections were conducted with NPM1-RFP mRNA using LipofectamineTM MessengerMAXTM (Invitrogen, LMRNA001) according to the manufacturer’s recommendations.

Purification:

Article Title: Orthogonal CRISPR-Cas tools for genome editing, inhibition, and CRISPR recording in zebrafish embryos
Article Snippet: Each vector was linearized using NotI restriction digest (NEB). .. Capped mRNA was synthesized using the HiScribe SP6 kit (NEB) and purified using the RNA Clean & Concentrator kit (Zymo). ..

Article Title: Orthogonal CRISPR-Cas tools for genome editing, inhibition, and CRISPR recording in zebrafish embryos.
Article Snippet: Each vector was linearized using NotI restriction digest (NEB). .. Capped mRNA was synthesized using the HiScribe SP6 kit (NEB) and purified using the RNA Clean & Concentrator kit (Zymo). ..

Synthesized:

Amplification:

Article Title: Interchromosomal interaction of homologous Stat92E alleles regulates transcriptional switch during stem-cell differentiation.
Article Snippet: .. The following primers were used for amplification: Forward: ACCCGCAGGACACCTAACCCGTCACCGTCCGATTTTTTTTTTGGAATTG TGAGCGGATAACAATT Reverse:CCCGCAGGACACCTAACCCGTCACCGTCCGACGACTCACTAT AGGGAGACGAT The same process was followed as described for the sense pool production, using HiScribe Sp6 kit (NEB) instead of T7. .. The secondary probes were designed to be complementary to the secondary sites, with fluorophores on both 5’ and 3’ ends of the oligo (IDT).

Review